Главная страница русский Войти или вступить в HDYO Дети Тинейджеры Молодые люди Родители ЮБГ Друзья Профессионалы Новости О нас Blog Видео Книги Научные исследования БГ Мероприятия Локальная поддержка Молодежная служба HDYO Ссылки Свяжитесь с нами Условия Конфиденциальность Язык Карта сайта Внести пожертвование Магазин
Дети Тинейджеры Молодые люди Родители ЮБГ Друзья Профессионалы

Ген болезни Гентингтона: под микроскопом

September 22, 2017

Huntington's Disease Youth Organization

На сайте HDYO имеется еше больше информации о БГ для молодых людей, родителей и специалистов:


Ген болезни Гентингтона: под микроскопом

Болезнь Гентингтона вызвана удлинением одного конкретного гена в ДНК человека. В этой статье рассматривается данный ген и его «удлинение». Мы также будем использовать родословное древо, чтобы показать, как ген наследуется и передается.

Гены, хромосомы и ДНК

DNA, chromosomes and genes

Сначала давайте рассмотрим некоторые основы, начиная с ДНК. ДНК - это название химического вещества, из которого сделаны наши гены. «ДНК» обозначает дезоксирибонуклеиновую кислоту (заковыристо, правда?). Неудивительно, что никто не использует полное имя - ДНК намного проще сказать и запомнить.

ДНК - это то, что мы наследуем от наших родителей, а они унаследовали её от своих родителей и так далее. Наша ДНК решает, кто мы такие, как мы выглядим, и как мы развиваемся. В нашей ДНК закладывается наш цвет волос, цвет глаз, высота, мужчина мы или женщина и даже особенности нашей индивидуальности.

ДНК - это название химического вещества, а гены - это так называемые инструкции, которые хранятся в ДНК. У нас много генов - точнее, в клетках нашего тела около 23 тысяч генов. Каждый ген представляет собой набор инструкций - как рецепт. Ген рассказывает клетке, как сделать химическое вещество, называемое белком. Белки - это машины, которые делают всю важную работу в наших клетках, от химических реакций до передачи сообщений из одной клетки в другую.

Гены связаны вместе, как сосиски, и упакованы в так называемые хромосомы. Всего у нас 46 хромосом. 23 передаются от одного родителя, а 23 - от другого. Каждая клетка в нашем теле содержит копию всех 46 хромосом.

Генетические изменения: ген болезни Гентингтона

С учетом основ, давайте теперь взглянем на ген Гентингтона. Иногда в хромосомах или генах происходят изменения (которые ученые называют «мутациями»). Эти изменения могут изменить способ работы тела и вызвать генетические нарушения. Даже крошечное изменение гена может привести к коренному изменению в белке. Представьте себе рецепт, который указывает шеф-повару готовить пирог за 400 минут вместо 40, и вы поймете, как небольшие изменения в записи в наших генах могут вызвать большие проблемы.

В 1993 ГОДУ ГРУППА ИССЛЕДОВАТЕЛЕЙ ОТКРЫЛА ГЕН, вызывающий болезнь Гентингтона на хромосоме 4. Было обнаружено, что одна часть гена повторяется снова и снова, как когда заикаются или слишком долго держат нажатой клавишу на клавиатуре компьююююююююююююююютера. Это повторение является причиной развития болезни Гентингтона и называется «ЦАГ-повторами».

Что такое «ЦАГ-повторы»?!

CAG repeats

Если вам интересно, почему статтер в гене Гентингтона называется ЦАГ-повтором, также как “ДНК» - это аббревиатура для некоторых сложных научных слов. В основном ДНК состоит из четырех оснований, которые известны как аденин (сокращенно A), цитозин ©, гуанин (G) и тимин (T). Эти базы - это код, лежащий в основе всей нашей ДНК и генов. У каждого гена есть другой код, и ученым лень записывать каждый раз все эти сложные слова, поэтому они просто используют короткие версии. Таким образом, четыре базы ДНК известны как A, C, G и T, и если нужно написать код гена, он выглядел бы примерно так: AAGTCCTGACTGGGCCTTGAGA CCTAG.

Если ген подобен рецепту, то основы похожи на алфавит из букв, составляющих инструкции в рецепте. Гены просто используют очень простой алфавит с четырьмя буквами на выбор. Но их написание столь же важно.

Ген, который вызывает болезнь Гентингтона, содержит раздел, где повторяются много раз основы С, А и G - «ЦАГ-повтор». Большинство копий гена содержат от 10 до 20 повторов, но иногда повторение увеличивается, и именно тогда оно начинает вызывать проблемы.


У каждого человека имеется две копии гена болезни Гентингтона, независимо от того, подвержены ли они опасности болезни Гентингтона или нет. Один экземпляр был унаследован от каждого родителя. И каждый ген болезни Гентингтона содержит ЦАГ-повтор в этом гене.

Причина развития заболевания в количестве ЦАГ-повторов. Проще говоря, у людей, у которых развивается болезнь Гентингтона, имеются более длинные ЦАГ-повторы, чем у остальных. Чтобы упростить объяснение, мы разделим ЦАГ-повторы на разные диапазоны. Только одна из копий должна удлиниться для того, чтобы возникли проблемы.

26 и ниже (Незатронутый диапазон

Как мы уже говорили, у каждого есть ЦАГ-повторы в его генах болезни Гентингтона (даже у людей из семей, не затронутых болезнью Гентингтона). У большинства людей, не страдающих болезнью Гентингтона, число ЦАГ-повторов составляет около 10-20. Фактически, любое число ЦАГ-повторов до 26 прекрасно и не вызовет никаких проблем. Но, как только это число превышается, могут возникнуть осложнения.

40 повторов и выше (диапазон заболевания)

У любого человека, у которого число ЦАГ-повторов составляет 40 или выше, к сожалению, обязательно будет развиваться болезнь Гентингтона в течение их жизни с 50% -ным риском передачи гена каждому из его детей. У большинства людей с болезнью Гентингтона число ЦАГ-повторов составляет от 40 до 50.

Повторения в среднем диапазоне от 27 до 39 встречаются довольно редко. Они немного менее понятны, и так как ученые не понимают их до конца, их иногда называют «неопределенной областью».

27-35 ЦАГ-повторов (риск для будущих поколений)

Положительная сторона диапазона повторов от 27 до 35 заключается в том, что у самого человека не будет развиваться болезнь Гентингтона. Тем не менее, существует небольшой риск (около 5%), что у детей этого человека может быть риск заболевания БГ. Это связано с тем, что повторы в этом диапазоне могут увеличиваться при передаче ребенку, достигая диапазона, при котором у ребенка может развиться БГ.

36-39 ЦАГ-повторов (пониженная пенетрантность)

у людей с повторами в этом диапазоне болезнь Гентингтона может развиться, а может и нет. У людей с таким диапазоном ЦАГ-повторов могут развиться симптомы болезни Гентингтона в более старшем возрасте. Иногда они могут умереть от старости до того, как начнутся какие-либо симптомы. Однако риск передачи заболевания детям в этом диапазоне составляет 50%. Ученые называют эту непредсказуемость «пониженной пенетрантностью».

Факт: ЦАГ-повторы - это то, что подсчитывают лабораторные специалисты, когда проводится ГЕНЕТИЧЕСКОЕ ТЕСТИРОВАНИЕ болезни Гентингтона.

Наследование патологического гена болезни Гентингтона

Итог: если ген заболевания Гентингтона имеет слишком много ЦАГ-повторов, это вызывает болезнь Гентингтона. Теперь давайте посмотрим, как люди наследуют этот патологический ген, и как болезнь Гентингтона может передаваться через семью.

50% -ный риск

50% risk

Люди приобретают болезнь Гентингтона, наследуя патологический ген от родителя. Поскольку мы наследуем одну копию каждой хромосомы от каждого родителя, у нас в итоге имеется две копии каждого гена - одна от матери, а другая - от отца.

Итак, больной хореей Гентингтона имеет две копии гена заболевания Гентингтона, один из которых удлинен (с большим количеством ЦАГ-повторов), а другой - нормальный.

У человека, не страдающего болезнью Гентингтона, также есть две копии гена болезни Гентингтона, но оба они являются нормальными.

Таким образом, ребенок, один родитель которого страдает болезнью Гентингтона, имеет один нормальный ген от здорового родителя, но мог унаследовать либо патологический ген, либо нормальный от родителя с болезнью Гентингтона.

Это создает 50%-ный риск унаследовать патологический ген.

Теоретически существует четыре возможных результата передачи генов (как видно на иллюстрации). В двух случаях у ребенка есть патологический ген, а в двух других - нет, поэтому шансы равняются 50 на 50. Чтобы все было проще понять, можно исключить родителя, у которого нет болезни Гентингтона, и просто сосредоточиться на том, наследует ли ребенок патологический ген или нормальный от родителя с болезнью Гентингтона. В любом случае риск составляет 50%.

Наследует ли человек патологический или нормальный ген зависит от чистой случайности, и именно поэтому иногда риск наследования болезни Гентингтона сравнивают с бросанием монеты. Каждый человек также подвержен своему 50-процентному риску, поэтому можно сказать, что у всех есть своя монета, которая бросается для определения их собственного риска.

Вероятность 25%

25% grandchild risk

Для некоторых, однако, риск не настолько неминуем, как в случае 50%. Например, если у дедушки и бабушки ребенка есть болезнь Гентингтона, а родитель ребенка, подверженный риску, не был протестирован, тогда у ребенка есть 25% вероятность унаследовать ген.

Это происходит потому, что мы не знаем, имеется ли у родителя патологический ген или нет. Если бы у родителя был патологический ген, тогда риск для ребенка составлял бы 50%.

Если у родителя нет патологического гена, тогда риск снижается с 25% до 0% - это означает, что у ребенка нет никакого риска заболеть. Таким образом, все зависит от того, какие гены унаследовал родитель. До тех пор, пока мы этого не узнаем, ребенок находится на уровне 25%-ного риска.

Аутосомная доминанта

Если у человека имеется один патологический ген и один нормальный ген, то почему именно патологический ген доминирует и вызывает болезнь Гентингтона? Почему нормальный ген не сопротивляется? Достаточно понять термин «аутосомная доминанта». К сожалению, болезнь Гентингтона - это так называемое «аутосомно-доминантное заболевание», а это означает, что хотя только одна копия из двух генов удлиняется, этого достаточно, чтобы вызвать болезнь. Другими словами, он доминирует над другим нормальным геном. Вот почему для генерации болезни требуется всего один удлиненный ген, а не два.

Таким образом, в этом разделе объясняется, что ген, который вызывает болезнь Гентингтона, удлиняется, поскольку в нем слишком много «ЦАГ-повторов», и что это число ЦАГ-повторов разделено на четыре диапазона. Мы рассмотрели риск наследования болезни Гентингтона и того, как оно происходит. И, несмотря на некоторые сложные термины, такие как «аутосомная доминанта», мы надеемся, что вы кое-что поняли, а не запутались еще больше. Если у вас возникли какие-либо вопросы, не стесняйтесь воспользоваться разделом ЗАДАТЬ ВОПРОС, где специалисты дадут отличные ответы, или напрямую СВЯЖИТЕСЬ С HDYO, если вы хотите задать конфиденциальный вопрос.